Question
Asked 5th Apr, 2020

Is it possible that cat owners have higher immunity for COVID-19?

In a paper deposited in BioRxiv entitled: "Susceptibility of ferrets, cats, dogs, and different domestic animals to SARS-coronavirus-2" the team from Harbin Vet Institute intentionally infected several species of animals including cats with SARS-CoV-2. The results showed that the virus was transmitted between the cats, but no sympthoms of COVID-19 were observed.
This result is interesting in terms of an observation made by a medic from Spain - Sabina Olex-Condor that from the 100 patients serious with COVID-19 that she examined there were no cat owners. She suggested as a hypothesis that due to cross-immunity (cats are a known reservoir of coronaviruses) cat owners have milder sympthoms of COVID-19.
I'm aware that the paper from Harbin Institute is a pilot study, has many possible dead ends and limitations. I'm also aware that this cross-immunity hypothesis suggested by Sabina need serious assement due to limited number (and problalbly non-representative set) of patients.
Do you think that this is possible in terms of knowledge of human immunology? If the above is met do any of you have access to indepth demografic (?) data of people infected with SARS-CoV-2 to check this hypothesis?
Disclaimer: not an expert in medicine or veterinary, I study plant genomics, this is pure scientific curiosity.
I hope that your families and friends are well.

Most recent answer

6th Sep, 2020
Mousumi Basu
Jadavpur University
Mario Bernardo-Filho,
may be your daughter has gained immunity against animal corona virus that exhibits "cross reactivity" against covid 19. This may be just a possibility, much more study and evidence are required to get hold of the actual fact.

Popular Answers (1)

25th Jul, 2020
Arvind Singh
Banaras Hindu University

All Answers (18)

16th Apr, 2020
Raquel Flores
Khalifa University
I have read somewhere else about this claim by Sabina Olex Condor, but haven't been able to find the source or original post/disclosure. Could you please share the link or tell us where to find it?
17th Apr, 2020
Brian Thomas Foley
Los Alamos National Laboratory
There are thousands of coronaviruses infecting mammals. Humans commonly are infected with four which cause common colds (229E, OC43, HKU1 and NL63) and we have also been infected by SARS-CoV (2003-2004 outbreak) and MERS-CoV (2013 and other small outbreaks), as well as this new (SARS-CoV-2 pandemic) strain. Cats and dogs, and bats and pigs and cattle and horses all have coronaviruses of various types infecting them too.
There is no evidence that other cat coronaviruses such as the Feline coronavirus UU21, or Feline infectious peritonitis virus, can infect humans or cause any cross-protection against SARS-CoV-2. These viruses are all very distantly related to each other, and so are the 4 human common cold coronavirses, so we would not expect any cross-protection at all. If that type of broadly cross-protective immunity was possible, then one human influenza vaccine would be good for all, and making a vaccine for HIV would be easy.
2 Recommendations
17th Apr, 2020
Mohamed Samy Abousenna
Central Laboratory for Evaluation of Veterinary Biologics, Agricultural Research Center, Egypt
What's the relationship between Human and cats immunity, I think the only hypothesis which could be considered if the SARS-CoV-2 is induced the infection to Human through carrier cats, in this case we could investigate if the cat immune system had impact on attenuation of SARS-CoV-2 or not
17th Apr, 2020
Brian Thomas Foley
Los Alamos National Laboratory
The SARS-CoV-2 virus did not originate in cats. It came from bats. It can infect humans and cats, but neither was the natural host for this virus. Even if it can infect cats, it is not clear if it can become pandemic in cats. We hope not. But it is recommended that humans infected with SARS-CoV-2 who own cats, should not let their cats roam outside, just as a precaution.
1 Recommendation
17th Apr, 2020
Alaa Raheem Kazim
Baghdad University College of Science
Following
17th Apr, 2020
Mohamed Samy Abousenna
Central Laboratory for Evaluation of Veterinary Biologics, Agricultural Research Center, Egypt
@Brian Thomas Foley I know it is originated from bats, I meant is there cat to human transmission or not, and if it's happening does it have impact on virus virulence, That's what should be considered
17th Apr, 2020
Muhammad Mustapha Jibril
Bayero University, Kano
Yes it is possible since they cohabit, there must have been a transfer of beneficial microbes from the cat to the owner. There are research evidences showing cats having some level of resistance to the flu virus, please refer the contribution made by Bartosz Ulaszewski and others, thank you.
1 Recommendation
17th Apr, 2020
Brian Thomas Foley
Los Alamos National Laboratory
Mohamed Samy Abousenna , first the virus would need to be transferred to a cat from a human, as it has only been spreading in humans for a short time. This is already proven to have happened in a tiger in a zoo, but I have not seen a report of it being proven in a housecat. Then the housecat would have to infect another human, and we would want to be sure that the human had not gotten the virus from another human (far more likely) than from the cat. It is possible in theory to study such things, but in practice most research is focused on the main pandemic at this point.
1 Recommendation
22nd Apr, 2020
Harasit Kumar Paul
Bangabandhu Sheikh Mujib Medical University
Theoretically, it is impossible to have higher immunity against the SARS-CoV2 virus (causative agent for COVID-19) among cat owners.
2 Recommendations
4th May, 2020
Israel-joshua Barde
National Veterinary Research Institute, Vom
SURE!
26th May, 2020
Chris Booker
University of Texas at San Antonio
Any study on this should control for presence of the toxoplasmosis parasite.
27th May, 2020
Israel-joshua Barde
National Veterinary Research Institute, Vom
THERE IS EVERY POSSIBILITY FOR THAT TO HAPPEN!
21st Jul, 2020
Mousumi Basu
Jadavpur University
I have read the news and seen the video in YouTube about the observations of Dr. Sabina Olex-Condo. Though the observation is in the very preliminary stage and needs further research but it seems very interesting from cross immunity point of view. Please share if you get any further information related to this.
25th Jul, 2020
Arvind Singh
Banaras Hindu University
25th Jul, 2020
Yehya A. Salih
University of Basrah
No, there is no studies refer to this topic.
I am responsible by a scientific group in my University, but cat and COVID19 is not my expertise; but I have interest in knowing and studying more. It is a very interesting curiosity. Cats and human biengs. It is a very interesting comment. I and my wife had COVID19, however, my daughter that is 30 years old, not. We live at the same house, and my daugther helped me and my wife during the terrible COVID19 days. My daugther has a cat, and many times the cat hurt her. Could the cat have to induce a protection in my daugther?
Can you help by adding an answer?

Similar questions and discussions

Fifth Sequence: COVID-19, 2 variants ATG-246-TT/CA-111-TAA; TTA = L, L-Type = 70%, TCA = S, S-Type = 30% in position 28144 of MN908947, for ORF8: NifB
Discussion
9 replies
  • Fernando Castro-ChavezFernando Castro-Chavez
For a "Mystery Protein · ORF8
The gene for this accessory protein is dramatically different in SARS-CoV-2 than in other coronaviruses. Researchers are debating what it does": ATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCCGTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTT/CACCTTTTACAATTAATTGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAA...; matches when translated into protein provide a similarity to NifB (Nitrogenase cofactor biosynthesis protein) while the nucleotide matches give a similarity to a short chain dehydrogenase/reductase family 16C member 5 (Sdr16c5) or some other dehidrogenase (see images below). Its subdivision into two strains originated from the article: "On the origin and continuing evolution of SARS-CoV-2", proposed by Xiaolu Tang et al. SO, such alternative sequence appearing in the 30% of the cases of COVID-19 is, for example: MT263469.
The other sequences analyzed in this space are:
Additional polymorphisms can be found in the excellent tool: https://nextstrain.org/groups/blab/sars-like-cov
COVID-19 : What are the relationship of Coronavirus (COVID-19) with other viruses ????
Question
38 answers
  • Siku BiologySiku Biology
The SARS-CoV-2 genome was rapidly sequenced by Chinese researchers. It is an RNA molecule of about 30,000 bases containing 15 genes, including the S gene which codes for a protein located on the surface of the viral envelope (for comparison, our genome is in the form of a double helix of DNA about 3 billion bases in size and contains about 30,000 genes).
Comparative genomic analyses have shown that SARS-CoV-2 belongs to the group of Betacoronaviruses and that it is very close to SARS-CoV, responsible for an epidemic of acute pneumonia which appeared in November 2002 in the Chinese province of Guangdong and then spread to 29 countries in 2003.
A total of 8,098 cases were recorded, including 774 deaths. It is known that bats of the genus Rhinolophus (potentially several cave species) were the reservoir of this virus and that a small carnivore, the palm civet (Paguma larvata), may have served as an intermediate host between bats and the first human cases.
Since then, many Betacoronaviruses have been discovered, mainly in bats, but also in humans. For example, RaTG13, isolated from a bat of the species Rhinolophus affinis collected in China's Yunan Province, has recently been described as very similar to SARS-CoV-2, with genome sequences identical to 96 percent.
These results indicate that bats, and in particular species of the genus Rhinolophus, constitute the reservoir of the SARS-CoV and SARS-CoV-2 viruses.
How to exactly determine the OD600 of E.coli suspension?
Question
55 answers
  • Peter RehbeinPeter Rehbein
I am relatively new to the field of microbiology and could need some help of more experienced scientists in the field:
I have grown an overnight-culture of E.coli BL21(DE3) in LB to an (apparent) OD600 of 2.
I tried to exactly determine the OD600, since the measured OD is by far above 0.4, I diluted the suspension 1/16 and got an OD600 of 0.39 which calculates for a "real" OD600 of 0.39*16 = 6.24
A dilution of 1/20 accordingly gave 0.17, 0.17*20=3,4
I understand that measuring OD600 is dependent on the spectrometer architecture and other things, but this difference in measurement undermines my confidence in the acquired values... Is there some way to get a better control over the OD600 measurement? Which is the best way to get a precise value of the OD of a high-density bacterial suspension?
I then more or less "assumed" 6 to be the correct OD600 of the overnight-culture, which gave me correct results after a second check up - a 1/60 dilution gave an OD of 0.09. I then tried to handle the overnight-culture as "stock solution" and pipetted the calculated volume of overnight-culture in the fresh incubation tubes to get OD600 values of exactly 0.02 for starting OD600. I then measured the resulting OD600, but these values were up to +/- 15% off the values I desired...
So my question is, is it possible to precisely create a suspension of e.g. OD600 = 0.02 from an overnight -culture of OD 6, and which would be the best way to do this?
Also, I want to try various media conditions (minimal media), and inoculating my prepared media with the LB-grown overnight culture would contaminate my prepared test-media with small but unwanted amounts of LB. Is the only option here centrifugation and resuspending the cells in the new medium? Which speed for centrifugation should be used so as to be able to separate the LB from the cells, but preventing the pellet from becoming too condensed, so that resuspension is still possible?

Related Publications

Article
Full-text available
Muito se pode dizer sobre o furac?o Covid-19, menos que seja uma crise inesperada. No passado recente tivemos H1N1, SARS, gripes sazonais, outras tantas doen?as e pandemias. Mas, ao que parece, embora muitas, tiveram pouca influência sobre a condu??o da saúde pública ao redor do mundo, imerso no receituário individualista neoliberal ao longo das úl...
Article
Efforts are intensifying to try to harness antibodies as a therapy for COVID-19. A study reveals the insights that can be gained from antibodies made by a person who had a coronavirus infection that caused the disease SARS. An antibody that neutralizes SARS-CoV-2.
Got a technical question?
Get high-quality answers from experts.